|
New England Biolabs
nebnext ultra tm ii rna library prep kit genotypic technologies Nebnext Ultra Tm Ii Rna Library Prep Kit Genotypic Technologies, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/NEBNext+Ultra+II+RNA+Library+Prep+Kit/bio_rxiv__64898__2026__04__06__709730-107-17-17 Average 99 stars, based on 1 article reviews
nebnext ultra tm ii rna library prep kit genotypic technologies - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Sequenom
massarray snp genotyping technology Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1 Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Amersham Life Sciences Inc
technologies discovery genotyping Technologies Discovery Genotyping, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/discovery+genotyping+technologies/sec_filing____40545_slash_000119312503069884_slash_d425-1085-12-16 Average 86 stars, based on 1 article reviews
technologies discovery genotyping - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology Plant Genotypes Seed Stocks Authentication Plants Phospho Eif4e Rabbit Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/Phospho-eIF4E+(Ser209)+Antibody/pmc11914046__41467_2025_57615_MOESM2_ESM-52-1-9 Average 96 stars, based on 1 article reviews
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
high-throughput snp genotyping with microarray technology High Throughput Snp Genotyping With Microarray Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/pmc11675768-136-6-0 Average 90 stars, based on 1 article reviews
high-throughput snp genotyping with microarray technology - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Qiagen
taqman snp genotyping assay life technologies n a rneasy kit qiagen Taqman Snp Genotyping Assay Life Technologies N A Rneasy Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/RNeasy+Mini+Kit/pm39255062-728-170-179 Average 99 stars, based on 1 article reviews
taqman snp genotyping assay life technologies n a rneasy kit qiagen - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Danaher Inc
rhamp snp genotyping technology Rhamp Snp Genotyping Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/pm38332006-106-39-43 Average 86 stars, based on 1 article reviews
rhamp snp genotyping technology - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Danaher Inc
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology Genotyping Primers Adar Reverse Gccacttctccctgactcctg Integrated Dna Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/Genotyping+Technology/pm38128529-262-33-38 Average 86 stars, based on 1 article reviews
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |